#!/usr/local/bin/perl -w # Author: lh3 use strict; use warnings; use Getopt::Std; my $usage = qq( Usage: fq_all2std.pl Command: scarf2std Convert SCARF format to the standard/Sanger FASTQ fqint2std Convert FASTQ-int format to the standard/Sanger FASTQ sol2std Convert Solexa/Illumina FASTQ to the standard FASTQ fa2std Convert FASTA to the standard FASTQ fq2fa Convert various FASTQ-like format to FASTA instruction Explanation to different format example Show examples of various formats Note: Read/quality sequences MUST be presented in one line. \n); die($usage) if (@ARGV < 1); # Solexa->Sanger quality conversion table my @conv_table; for (-64..64) { $conv_table[$_+64] = chr(int(33 + 10*log(1+10**($_/10.0))/log(10)+.499)); } # parsing command line my $cmd = shift; my %cmd_hash = (scarf2std=>\&scarf2std, fqint2std=>\&fqint2std, sol2std=>\&sol2std, fa2std=>\&fa2std, fq2fa=>\&fq2fa, example=>\&example, instruction=>\&instruction); if (defined($cmd_hash{$cmd})) { &{$cmd_hash{$cmd}}; } else { die("** Unrecognized command $cmd"); } sub fa2std { my %opts = (q=>25); getopts('q:', \%opts); my $q = chr($opts{q} + 33); warn("-- The default quality is set to $opts{q}. Use '-q' at the command line to change the default.\n"); while (<>) { if (/^>(\S+)/) { print "\@$1\n"; $_ = <>; print "$_+\n", $q x (length($_)-1), "\n"; } } } sub fq2fa { while (<>) { if (/^@(\S+)/) { print ">$1\n"; $_ = <>; print; <>; <>; } } } sub scarf2std { while (<>) { my @t = split(':', $_); my $name = join('_', @t[0..4]); print "\@$name\n$t[5]\n+\n"; my $qual = ''; @t = split(/\s/, $t[6]); $qual .= $conv_table[$_+64] for (@t); print "$qual\n"; } } sub fqint2std { while (<>) { if (/^@/) { print; $_ = <>; print; $_ = <>; $_ = <>; my @t = split; my $qual = ''; $qual .= $conv_table[$_+64] for (@t); print "+\n$qual\n"; } } } sub sol2std { my $max = 0; while (<>) { if (/^@/) { print; $_ = <>; print; $_ = <>; $_ = <>; my @t = split('', $_); my $qual = ''; $qual .= $conv_table[ord($_)] for (@t); print "+\n$qual\n"; } } } sub instruction { print " FASTQ format is first used in the Sanger Institute, and therefore we take the Sanger specification as the standard FASTQ. Although Solexa/Illumina reads file looks pretty much like the standard FASTQ, they are different in that the qualities are scaled differently. In the quality string, if you can see a character with its ASCII code higher than 90, probably your file is in the Solexa/Illumina format. Sometimes we also use an integer, instead of a single character, to explicitly show the qualities. In that case, negative qualities indicates that Solexa/Illumina qualities are used. "; } sub example { my $exam_scarf = ' USI-EAS50_1:4:2:710:120:GTCAAAGTAATAATAGGAGATTTGAGCTATTT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 19 23 23 23 18 23 23 23 USI-EAS50_1:4:2:690:87:GTTTTTTTTTTTCTTTCCATTAATTTCCCTTT:23 23 23 23 23 23 23 23 23 23 23 23 12 23 23 23 23 23 16 23 23 9 18 23 23 23 12 23 18 23 23 23 USI-EAS50_1:4:2:709:32:GAGAAGTCAAACCTGTGTTAGAAATTTTATAC:23 23 23 23 23 23 23 23 20 23 23 23 23 23 23 23 23 23 23 23 23 12 23 18 23 23 23 23 23 23 23 23 USI-EAS50_1:4:2:886:890:GCTTATTTAAAAATTTACTTGGGGTTGTCTTT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 USI-EAS50_1:4:2:682:91:GGGTTTCTAGACTAAAGGGATTTAACAAGTTT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 20 23 23 23 23 23 23 23 23 23 23 23 18 23 23 23 23 USI-EAS50_1:4:2:663:928:GAATTTGTTTGAAGAGTGTCATGGTCAGATCT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 '; my $exam_fqint = ' @4_1_912_360 AAGGGGCTAGAGAAACACGTAATGAAGGGAGGACTC +4_1_912_360 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 21 40 40 40 40 40 40 40 40 40 26 40 40 14 39 40 40 @4_1_54_483 TAATAAATGTGCTTCCTTGATGCATGTGCTATGATT +4_1_54_483 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 40 40 40 28 40 40 40 40 40 40 16 40 40 5 40 40 @4_1_537_334 ATTGATGATGCTGTGCACCTAGCAAGAAGTTGCATA +4_1_537_334 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 21 29 40 40 33 40 40 33 40 40 33 31 40 40 40 40 18 26 40 -2 @4_1_920_361 AACGGCACAATCCAGGTTGATGCCTACGGCGGGTAC +4_1_920_361 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 40 40 40 40 40 40 40 40 31 40 40 40 40 40 40 15 5 -1 3 @4_1_784_155 AATGCATGCTTCGAATGGCATTCTCTTCAATCACGA +4_1_784_155 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 31 40 40 40 40 40 @4_1_595_150 AAAGACGTGGCCAGATGGGTGGCCAAGTGCCCGACT +4_1_595_150 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 40 40 40 40 40 40 40 20 40 40 40 40 40 14 40 40 '; my $exam_sol = ' @SLXA-B3_649_FC8437_R1_1_1_610_79 GATGTGCAATACCTTTGTAGAGGAA +SLXA-B3_649_FC8437_R1_1_1_610_79 YYYYYYYYYYYYYYYYYYWYWYYSU @SLXA-B3_649_FC8437_R1_1_1_397_389 GGTTTGAGAAAGAGAAATGAGATAA +SLXA-B3_649_FC8437_R1_1_1_397_389 YYYYYYYYYWYYYYWWYYYWYWYWW @SLXA-B3_649_FC8437_R1_1_1_850_123 GAGGGTGTTGATCATGATGATGGCG +SLXA-B3_649_FC8437_R1_1_1_850_123 YYYYYYYYYYYYYWYYWYYSYYYSY @SLXA-B3_649_FC8437_R1_1_1_362_549 GGAAACAAAGTTTTTCTCAACATAG +SLXA-B3_649_FC8437_R1_1_1_362_549 YYYYYYYYYYYYYYYYYYWWWWYWY @SLXA-B3_649_FC8437_R1_1_1_183_714 GTATTATTTAATGGCATACACTCAA +SLXA-B3_649_FC8437_R1_1_1_183_714 YYYYYYYYYYWYYYYWYWWUWWWQQ '; print qq( solexa ====== $exam_sol scarf ===== $exam_scarf fqint ===== $exam_fqint ); }